P-glycoprotein activation as a mechanism of drug resistance to carfilzomib in multiple myeloma cells

Cover Page

Cite item

Full Text

Abstract

Introduction. Carfilzomib (CFZ) is a second-generation proteasome inhibitor and serves as a constant component of multiple myeloma recurrence therapy. However, the mechanisms of development of resistance to CFZ have not been sufficiently studied.

Aim. To investigate the mechanisms of development of CFZ resistance in multiple myeloma cells.

Materials and methods. The study was performed in 2 multiple myeloma cell lines: АМО-1 and its CFZ-resistant subline АМО-1/CFZ. Cytotoxicity of the compounds was evaluated using the MTT assay, gene expression levels using real-time polymerase chain reaction. To evaluate protein expression, flow cytometry and western blot were used. Protein location was determined using immunocytochemistry, interaction with P-glycoprotein (P-gp) was evaluated using rhodamine accumulation assay.

Results. We have obtained a cell subline АМО-1/CFZ which was 46-fold more resistant to CFZ than initial cell line АМО-1. Genes of proteasome subunits did not change significantly compared to АМО-1. We have determined that CFZ is a substrate for P-gp and promotes its expression at the levels of messenger RNA and protein. Concurrent treatment of АМО-1/CFZ cells with nontoxic concentrations of P-gp inhibitor elacridar and CFZ led to complete restoration of sensitivity to this proteasome inhibitor. Activity of YB-1 protein, one of the possible transcription factors of P-gp, did not change in the resistant subline АМО-1/CFZ.

Conclusion. Therefore, P-gp hyperexpression mediates CFZ resistance in АМО-1/CFZ cells. However, molecular mechanisms leading to P-gp hyperexpression remain unknown.

Full Text

INTRODUCTION

Proteasome inhibitors (PIs) are effective in the treatment of hematological malignancies, particularly multiple myeloma (MM), as MM cells produce a large amount of paraprotein. The optimal functioning of the proteasome complex is critically important in these cells [1].

The first PI, bortezomib was approved by the U.S. Food and Drug Administration (FDA) in 2003. Since then, it has become a cornerstone of therapy not only for patients with relapsed or refractory myeloma but also for those with newly diagnosed MM. Subsequently, the second-generation proteasome inhibitors carfilzomib (CFZ) and ixazomib were approved. All of them have been incorporated into several treatment regimens in combination with other cytotoxic agents, such as alkylating agents, immunomodulatory drugs, and monoclonal antibodies [2]. Although PIs of both the first and second generations can significantly improve the condition of patients with myeloma, resistance to these drugs ultimately develops [3].

Acquired resistance develops gradually as a result of sequential genetic and epigenetic changes, which ultimately confer a complex drug-resistant phenotype to tumor cells [4]. Resistance to PIs can develop through specific pathways, such as mutations in the genes encoding proteasome subunits, increased expression of these subunits, and the assembly of alternative proteasomal complexes [5]. Non-specific pathways include enhanced resistance to apoptosis, impaired DNA repair, increased drug inactivation, enhanced drug efflux from cells and other.

Elevated expression and mutations of the PSMB5 gene, which encodes the catalytic β5 subunit of the proteasome, can be the mechanism of PI resistance development in MM cells, although there is a lack of significant clinical evidence to support this hypothesis [5]. Interest in immunoproteasomes (i-subunits), which are encoded by the PSMB8 (β5i), PSMB9 (β1i) and PSMB10 (β2i) genes, has increased significantly in recent years [6]. Levels of β5i were higher in the proteasomes of HLA-sensitised MM patients on dialysis [7], and even higher in patients in remission after CFZ therapy [8]. However, different studies have found either decreased and increased expression of 19S particles or some of their subunits in PI-resistant cells [5]. In general, there are few works devoted to the study of immunoproteasomes in CFZ-resistant MM cells.

One of the non-specific pathways associated with the development of resistance to PIs is the activation of drug release from the cells. Resistance often develops simultaneously to multiple drugs that differ in their chemical structure and mechanism of action on the cell. This phenomenon is known as multidrug resistance (MDR) [9, 10]. P-glycoprotein (P-gp, ABCB1) is one of the key proteins responsible for the development of MDR in tumor cells. It belongs to the ABC-transporter family and is encoded by the ABCB1 gene (MDR1). Several studies have described the functional role of P-gp in CFZ resistance. For instance, increased expression of ABCB1 has been observed in cells derived from patients with plasma cell leukaemia, which is the most aggressive stage of MM, compared to untreated patients’ bone marrow plasma cells [11]. The CFZ-resistant AMO-1 cell line with ABCB1 knockout exhibited greater sensitivity to CFZ and other P-gp substrates than ABCB1-positive cells of this line [12]. Based on these findings, we believe that a detailed study of the role of P-gp in the development of CFZ resistance in MM is promising. However, the functional activity of the P-gp protein in MM cells has received little attention. To date, only one paper by Besse et al. has demonstrated a decrease in P-gp substrate release of Mitotracker Green FM under the influence of its potential inhibitors nelfinavir and lopinavir [11].

A search for regulators of P-gp expression in MM cells is also needed. One such regulator may be the YB-1 protein. The multifunctional DNA/RNA-binding protein YB-1 has been shown to act as a transcription factor for P-gp when translocated from the cytoplasm to the nucleus [13]. YB-1 represents a promising target for MM treatment, as it has been demonstrated to regulate the expression of genes that are important for MM progression, including MYC and MMSET [14].

Thus, studying the mechanisms of resistance to PIs in MM cells is essential for the further productive use of this class of drugs and will help in identifying new biomarkers of drug resistance in the future.

Aim of the study to investigate the mechanisms of drug resistance to CFZ in MM cells.

MATERIALS AND METHODS

Cell culture. The study utilized MM AMO-1 cells (Leibniz Institute DSMZ) (https://webshop.dsmz.de/en/human-animal-cell-lines/AMO-1.html) and K562/iS-9_Dox cells with functionally active P-gp [15]. Cells were cultured in RPMI1640 medium (PanEco, Russia) supplemented with 20 % fetal bovine serum (FBS) (Gibco, USA) for AMO-1 cells and their subline, and 10 % FBS for K562/iS-9_Dox cells. The medium also contained a combination of antibiotics: 5000 µg/mL streptomycin and 5000 U/mL penicillin (PanEco, Russia). Cultures maintained in an incubator at 37 °C in a humidified atmosphere of 5 % CO2.

MTT assay. Cells were seeded in 96-well plates at a density of 25,000 cells per well in 135 µL of culture medium. CFZ (Sionc Phar., India) was added to each well in various concentrations, with 15 µL of the drug solution. To the control wells, 15 µL of serum-free medium (SFM) was added. The cells were incubated with the drug for 72 hours. The method is described in detail in our previous publication [16].

The experiment with combined treatment using CFZ and the P-gp inhibitor elacridar (ELA, Cayman Chemical, USA) was performed as follows: AMO-1 and AMO-1/CFZ cells were seeded at a density of 35,000 cells per well in 120 µL of medium for 24 hours. On the same day, CFZ (15 µL) at various concentrations was added to one group of cells along with 15 µL of SFM, while to another group, CFZ (15 µL) was combined with ELA (15 µL). Two additional controls were also set up: untreated cells (120 µL of cell suspension + 30 µL of SFM) and cells treated with ELA (15,3 µM for AMO-1 cells and 12 µM for AMO-1/CFZ cells) + 15 µL of SFM. The results evaluated as described for the standard MTT assay.

Real-time polymerase chain reaction. Total RNA extracted from cells using PureZOL reagent (Bio-Rad, USA) according to the manufacturer’s protocol. A detailed description of the methodology can be found in a previously published work [17]. Data normalization performed using the housekeeping gene RPLP0, with the primer sequences provided in table 1.

 

Table 1. Primer sequences for gene expression analysis in real-time polymerase chain reaction

Gene

Forward primer

Reverse primer

PSMB1/β1

CAATCCTGTATTCAAGGCGCTTC

TCTCTCTGGTAAGACCCTACTGG

PSMB2/β2

ACTACACACCGACTATCTCACG

GATTCGAACACTGAAGGTTGGC

PSMB5/β5

AGTCTCAGTGATGGTCTGAGC

CAATGTAAGCACCCGCTGTAG

PSMB8/β5i

GTGATTGCAGCAGTGGATTCTC

ATGGTGCCAAGCAGGTAAGG

PSMB9/β1i

CTGGGACCAACGTGAAGGAG

CCAATGGCAAAAGGCTGTCG

PSMB10/β2i

GGGCTTCTCCTTCGAGAACTG

AGAATGACCCCGTCTTGGAAC

ABCB1

GGGATGGTCAGTGTTGATGGA

GCTATCGTGGTGGCAAACAATA

RPLP0

CCTTCTCCTTTGGGCTGGTCATCCA

CAGACACTGGCAACATTGCGGACAC

 

Flow cytometry. Protein expression assessed using direct immunofluorescence with monoclonal antibodies FITC-P-glycoprotein (Cat. #557002, BD Pharmingen, USA). Non-fixed cell suspensions (500,000 cells per sample) incubated in 100 µL of PBS (phosphate-buffered saline) with antibodies at the manufacturer-recommended ratio for 40 minutes in the dark at room temperature. The cells washed twice with PBS. Fluorescence analyzed on a FACSCanto II flow cytometer (BD Biosciences, USA) with DiVa software.

Assessment of P-glycoprotein functional activity. K562/i-S9 cells were incubated for 20 minutes in culture medium containing 2.0 µg/mL rhodamine 123 (Rh123; Sigma-Aldrich, USA). In the absence of P-gp expression, Rh123 remains in the cells for three or more hours. If P-gp is overexpressed and functional, it effluxes Rh123 within 20–40 minutes. When a compound that is a substrate or inhibitor of P-gp is added, the release of Rh123 is slowed down or completely inhibited. Conversely, if the compound does not interact with P-gp, Rh123 is released from the cells within 20–40 minutes. A detailed description of the method can be found in our previous publication, with the only modification being the use of ELA instead of verapamil [15].

Western blot. Cells were suspended in 150 µL of RIPA lysis buffer (150 mM NaCl, 5 mM EDTA, 1 % NP-40, 0.5 % Sodium Deoxycholate, 0.1 % SDS, 25 mM Tris-HCl, PhosSTOP protease inhibitors) and incubated on ice for 30 minutes. The lysate centrifuged at 14,000 rpm for 15 min, and the protein-containing supernatant transferred to a new tube. Protein concentration was determined using the BCA protein assay kit (Millipore, USA). The cells were then suspended in 4× Laemmli buffer (50 mM Tris-HCl, pH 6.8, 100 mM β-mercaptoethanol, 1 % SDS, 10 % glycerol, 0.005 % bromophenol blue) and heated at 95 °C for 5 minutes.

Proteins (30 µg per well) were separated on 10 % SDS-PAGE gels and transferred to a nitrocellulose membrane (Amersham, USA). The membrane was incubated with 5 % BSA in TBST (Tris-Buffered Saline with Tween; 150 mM NaCl, 50 mM Tris-HCl, 0.1 % Tween-20, pH 7.6) with continuous shaking for 60 minutes. The membrane was then incubated overnight at 4 °C with specific antibodies against P-gp (1:500, Cat. No. 26528, Invitrogen, USA), actin-specific antibodies directly conjugated with peroxidase (1:1000, Cat. No. 47778, Santa Cruz, USA).

Subsequently, the membrane washed three times in TBST for 15 minutes each. YB-1 (1:1000, Cat. No. A15696, Abclonal, Germany) and p-YB-1 (Ser102) antibodies (1:1000, Cat. No. 2900S, Cell Signaling, USA) were used in the assessment of YB-1 and p-YB-1 expression. The membranes were then incubated with secondary antibodies conjugated with peroxidase (1:4000) for 1 hour. Anti-mouse antibodies (Cat. No. 7076, Cell Signaling, USA) for P-gp and anti-rabbit YB-1 and p-YB-1 (Cat. No. 7074, Сell Signaling) were used. Incubation followed by three washes in TBST. The proteins were detected using ECL reagent (Thermo Fisher, USA), and imaging performed using the ImageQuant Las4000 luminometer (USA).

Immunocytochemystry. Immunocytochemical staining of AMO-1 and AMO-1/CFZ cells was performed according to the manufacturer’s protocol using YB-1/YBX1 rabbit pAb primary antibodies (Cat. A-15696, ABclonal, Germany) (https://abclonalbio.com/Uploads/protocol/IF_protocol. pdf). From each culture, 2×106 cells were incubated with YB-1/YBX1 primary antibodies (1:100) overnight at 4 °C. After washing, goat anti-rabbit IgG Alexa Fluor® 488 secondary antibodies (1:200, Cat. No. A-11070, Invitrogen, USA) were added, Hoechst 33342 (1.25:1000, Sigma-Ald., USA) was added to visualize the nuclei, phalloidin (1:400, Sigma-Aldrich, USA) was used to visualize the cytoplasm and incubated for 75 minutes. After three washes with 0.1 % Tween 20 in PBS, 5 μL of cells were mixed with 5 μL of elvanol, covered with a coverslip and incubated for 2 hours in a thermostat. The distribution of YB-1 protein in the cells was evaluated using a fluorescence microscope (Axioplan, ZEISS, Germany), Olympus DP70 camera at 50x magnification.

Statistical analysis. Experiments performed 4–5 times to quintuplicate for MTT and real-time polymerase chain reaction and 2–3 times for Western blot and Rh123 assay, and the data are presented as mean ± standard deviation (M ± SD). Statistical analysis was conducted using GraphPad Prism 9.0 software. Kolmogorov–Smirnov test of normality was used and then Student’s t-test was applied. Differences considered statistically significant at a p-value <0.05.

RESULTS

Evaluation of resistance to proteasome inhibitors in multiple myeloma subline. At the initial stage of the study, we developed a model to investigate the mechanisms of resistance acquisition to CFZ. To induce resistance, AMO-1 cells cultured in the presence of CFZ, with the drug concentration gradually increased as the cells adapted to the current dose. The initial concentration corresponded to an 30 % inhibitory concentration (IC30) value of 2 nM: the concentration resulting in 70 % cell viability compared to the initial seeding density (hemocytometer count). The concentration increment was approximately 1–2 nM during the early stages and 10 nM in the later stages of selection. As a result of this approach, the resistant subline, AMO-1/CFZ, was generated. This subline demonstrated a 46-fold higher resistance to CFZ compared to the sensitive AMO-1 cells (fig. 1), with half maximal inhibitory concentration (IC50) values of 249.2 ± 24.5 and 5.4 ± 1.1 nM, respectively (p <0.0001). AMO-1/CFZ showed no cross-resistance to PI ixazomib (17.0 ± 2.5 vs 32.3 ± 9.1; p = 0.2), but displayed a 2.3-fold resistance to the PI bortezomib (2.7 ± 0.7 nM vs 5.0 ± 0.2 nM; p = 0.002) and an 8.8-fold resistance to doxorubicin (0.16 ± 0.02 μM vs 1.4 ± 0.3 μM; p = 0.04), a classic P-gp substrate.

 

Fig. 1. Cytotoxic effect of carfilzomib on AMO-1 and AMO-1/CFZ, 72 hours of incubation: a – cells survival curves under the influence of carfilzomib (MTT test); b – statistical significance of the obtained results (t-test)

 

Gene expression changes associated with carfilzomib resistance. Numerous studies have linked resistance acquisition to alterations in the expression of PSMB family genes, which encode the catalytic β-subunits of proteasomes. In the next phase of our study, we evaluated the changes in PSMB gene expression at the messenger RNA (mRNA). level. Our experiments revealed increased expression of i-subunits genes, including a 2.0-fold increase for PSMB1i (p = 0.002) and a 2.8-fold increase for PSMB5i (p = 0.0007), and no changes of constitutive proteasomes genes expression and PSMB2i gene expression (fig. 2, a, b).

 

Fig. 2. Expression of mRNA genes in the sensitive AMO-1 and the resistant AMO-1/CFZ subline (a) genes PSMB1, PSMB2, PSMB5, encoding catalytic subunits of constitutive proteasomes (b) genes PSMB1i, PSMB2i, PSMB5i, encoding immunoproteasomes and (c) ABCB1 gene, encoding P-gp (real-time polymerase chain reaction, relative expression 2ΔCt), housekeeping gene RPLP0)

 

Thus, only minor changes in the expression of immunoproteasome subunit genes were observed. Therefore, we further assessed the expression of ABC-transporter gene – ABCB1, encoding P-gp (fig. 2, c). Our analysis showed 67-fold pronounced increase of ABCB1 expression in AMO-1/CFZ cells (p = 0.0003).

Assessment of P-glycoprotein expression in AMO-1 and AMO-1/CFZ cells. Next, we analyzed P-gp expression at the protein level. In contrast to parental AMO-1 cells, where P-gp was undetectable by Western blot and only 1.6 % of cells were positive by flow cytometry (fig. 3 a, b), the resistant AMO-1/CFZ subline showed significant P-gp expression. Western blot analysis confirmed this finding (see fig. 3, a), and approximately 53 % of the resistant cells exhibited surface P-gp expression (see fig. 3, с).

 

Fig. 3. P-glycoprotein (P-gp) expression in AMO-1 and AMO-1/CFZ cells determined by Western blot, β-actin was used as a loading control (a); P-gp expression in AMO-1 (b) and AMO-1/CFZ cells (c) determined by flow cytometry. FCS-H – forward scatter height

 

Assessment of carfilzomib binding to P-glycoprotein using a functional Rhodamine 123 efflux assay. To confirm the interaction between P-gp and CFZ, we assessed the binding of CFZ to the protein using the well-established Rhodamine 123 (Rh123) efflux assay. We employed the K562/i-S9_Dox cell line because it exhibits stable, high-level P-gp expression due to a lentiviral construct. This is in contrast to the AMO-1/CFZ cells, where P-gp levels decrease over time. The K562/i-S9_Dox model is a versatile tool that provides a clear and consistent system for demonstrating qualitative interactions between P-gp and various compounds. The incubation of K562/i-S9_Dox cells in medium with Rh123 (95.9 % of cells stained with Rh123) for a period of 40 minutes, followed by incubation in pure medium, resulted in the release of the majority of Rh123 (17.6 % of cells remained stained) from the cells by the P-gp protein. The incubation of cells with elacridar (ELA) resulted in the inhibition of P-gp activity (fig. 4), which in turn led to a reduction in Rh123 efflux from cells (95.1 % of cells remained stained). Incubation of cells in the medium with CFZ (see fig. 4, a) resulted in a decrease in the release of Rh123 (44.2 % of cells were stained), since this PI competed with Rh123 for binding to P-gp. Based on this, we can conclude that CFZ is a moderate-strength substrate of P-gp. Fig. 4, b also demonstrates the outcome of the experiment with another PI, ixazomib, which is not a substrate of P-gp (11.1 % of stained cells).

 

Fig. 4. Evaluation of carfilzomib (a) and ixazomib (b) effect on the release of Rh123 (fluorescent compound, P-glycoprotein substrate) in P-glycoprotein overexpressing K562/i-S9_Dox cells (flow cytometry). Following a 20-minute incubation period with Rh123, the cells were further incubated for 40 minutes in either fresh medium, or medium containing elacridar, or carfilzomib, or ixazomib

 

Evaluation of the effect of elacridar, a P-glycoprotein inhibitor, on the sensitivity of cells to carfilzomib. At the next stage of our work, we compared the sensitivity of cells to which only CFZ was added and cells that were incubated both ELA and CFZ using MTT assay (fig. 5). It was determined that CFZ exhibited 39 times greater cytotoxicity towards AMO-1/CFZ cells in the presence of ELA (IC50 = 2868.1 ± 177.7 nM versus IC50 = 73.4 ± 12.1 nM). ELA almost does not affect the sensitivity of AMO-1 cells, since they do not express P-gp (IC50 = 91.4 ± 29.9 nM when exposed to CFZ and IC50 = 77.4 ± 26.6 nM when exposed to CFZ and ELA). The statistical significance of the IC50 values for CFZ, when added to AMO-1 or AMO-1/CFZ cells, individually or in combination with ELA, is illustrated in fig. 5, b.

 

Fig. 5. Cytotoxic effect of carfilzomib (cfz) combined with P-glycoprotein inhibitor elacridar (ela) on AMO-1 and AMO-1/CFZ cells; ela was added at a concentration of 3 µM for AMO-1 cells and 12 µM for AMO-1/CFZ cells, incubated for 24 hours: a – cell survival curves (MTT assay); b – statistical significance of the obtained results (t-test). ns – no significant

 

Determination of YB-1 protein expression and localization in sensitive and resistant cell lines. In order to determine the expression levels of one of the putative transcription factors for ABCB1 gene, YB-1 protein, and its phosphorylated form (p-YB-1) (Ser102) Western blot was carried out (fig. 6, a). It was determined that their expression did not differ between the sensitive and resistant sublines (see fig. 6, b).

 

Fig. 6. YB-1 and p-YB-1 expression levels in AMO-1 and AMO-1/CFZ cells, β-actin was used as a loading control (Western blot) (а). Densitometry was performed based on the Western blot results. Statistical significance of the obtained results (t-test) (b). ns – no significant

 

To determine the distribution between cytoplasm and nucleus of YB-1 protein in AMO-1 cells and in AMO-1/CFZ subline, an immunocytochemical study was performed (fig. 7). Based on the obtained data, in 34 % of AMO-1 cells the localization of YB-1 protein is predominantly nuclear, in 39.5 % – diffuse, i. e. YB-1 protein is distributed throughout the cell, in 16 % – cytoplasmic and in 10.5 % of cells the level of YB-1 expression is minimal. In the case of AMO-1/CFZ subline, in 40 % of cells the localization of YB-1 is predominantly nuclear, in 32 % it is diffuse, in 8 % it is cytoplasmic and in 20 % of cells the level of YB-1 expression is minimal. Thus, no significant changes in protein localization were observed.

DISCUSSION

To understand how MM cells acquire resistance to CFZ, we developed the AMO-1/CFZ subline, which is 46 times more resistant to CFZ than its parental counterpart, AMO-1 (see fig. 1), and comparative analysis conducted on this pair. In the first stage, we determined that AMO-1/CFZ subline does not exhibit cross-resistance to ixazomib but shows low resistance to bortezomib. First, we investigated PSMB genes expression, because aberrant expression of PSMB genes considered a critical adaptation of tumors to the action of PIs. AMO-1/CFZ cells demonstrated increased expression of all immunoproteasome subunits genes PSMB1i and PSMB5i (see fig. 2, b). E. Woodle et al. [8] have also reported elevated immunoproteasome expression under the influence of CFZ. M. J. Lee et al. elucidated the molecular mechanisms underlying intrinsic resistance to CFZ in human bronchial carcinoid H727 cells, which retained sensitivity to other PIs, notably bortezomib [18]. In this study, the authors suggest a potential link between the composition of proteasomal catalytic subunits and cellular response to CFZ. H727 cells exhibited a mixed proteasome expression profile, comprising both constitutive and immunoproteasome subunits. We observed an increase in the expression of 2 out of 6 proteasome genes, which may indirectly indicate the presence of mixed proteasomes, and this heterogeneity could contribute to the cells’ differential sensitivity to CFZ. However, the extent of upregulation in PSMB gene expression did not fully account for the resistance acquisition observed in AMO-1/CFZ cells.

Since AMO-1/CFZ cells showed cross-resistance to doxorubicin, a drug known as a P-gp substrate, we analyzed its amount. We demonstrated that AMO-1/CFZ cells exhibit higher P-gp expression level at both mRNA and protein levels (see fig. 2, c, 3), and CFZ acts as a moderate-strength substrate for P-gp (see fig. 4). We propose that increased P-gp expression level serves as the key mechanism underlying CFZ resistance acquisition in AMO-1/CFZ cells. This assumption supported by experiments involving the combined treatment with CFZ and ELA, a P-gp inhibitor. At non-toxic concentrations, ELA enhanced the efficacy of CFZ in AMO-1/CFZ cells by 39-fold, effectively restoring their sensitivity to PIs to a level that was just above that of the original AMO-1 cell line (see fig. 5).

However, existing studies show contradictory results regarding P-gp expression changes following PI treatment. For instance, in the study by R. L. Mynott and C. T. Wallington-Beddoe, which examined eight human MM cell lines, including RPMI-8226 cells resistant to bortezomib and CFZ, P-gp not detected either on the cell surface or in whole-cell lysates. P-gp accumulation observed in only one of the tested cell lines, KMS-18, but it confined to the intracellular compartment and not expressed on the membrane. Furthermore, the researchers observed that P-gp blockade using tariquidar (a third-generation inhibitor) failed to enhance KMS-18 cell sensitivity to cfz [19].

In our study, in contrast, we detected the presence of P-gp not only in cell lysates but also on the surface of the AMO-1/ CFZ subline in response to CFZ exposure. Additionally, we noted sensitization of AMO-1/CFZ cells to CFZ when treated concurrently with CFZ and non-toxic doses of ELA. The ability of P-gp inhibitors (such as ELA and tariquidar) to increase CFZ cytotoxicity appears dependent on cell surface P-gp expression, as demonstrated in our model system. Our findings largely supported by other researchers who have also used AMO-1 cells as a model system [12, 13]. Additionally, a study by K. Takahashi et al. on acute lymphoblastic leukemia cells demonstrated that the sensitivity of a P-gp-positive cell line to CFZ increased after knocking out P-gp in these cells using genome editing with the CRISPR/Cas9 system [20]. However, our findings combined with existing literature demonstrate that P-gp overexpression in response to CFZ is not universal across MM cell lines, suggesting the involvement of additional molecular determinants for its activation.

Therefore, we propose, that transcription factor YB-1 may create a favorable environment for the activation of P-gp in AMO-1 upon prolonged CFZ exposure. In our study, we examined the distribution and expression levels of the YB-1 protein in AMO-1 and AMO-1/CFZ cells. While YB-1 showed high expression levels in both parental cells and the resistant subline, no quantitative differences were observed between total and phosphorylated forms, and its subcellular localization (nuclear vs. cytoplasmic) remained unchanged (see fig. 6, 7). In our previous study, we demonstrated high YB-1 expression in RPMI8226 and NCI-H929 MM cells. However, in these cultures, YB-1 was predominantly cytoplasmic (90–95 % of cells), and its localization remained unchanged in bortezomib-resistant sublines [17]. The AMO-1 cell line displays a distinct basal YB-1 distribution pattern: when combining cells with complete nuclear and partial nuclear (diffuse) localization, the percentage ranges between 70–75 %. This pattern potentially indicates pre-activation of YB-1, though additional cofactors appear necessary for P-gp expression induction. Alternatively, YB-1 might not participate in P-gp regulation specifically in this cell line. Notably, exist clinical evidence of YB-1 involving: a study analyzing samples from 22 MM patients revealed significant co-expression of YB-1 mRNA with ABCB1 (MDR1), and the APE1/YB-1/MDR1 gene signature’s association with adverse clinical outcomes [21].

CONCLUSION

Our research established P-gp as a critical factor in CFZ resistance in AMO-1 MM cells. For the first time, we simultaneously demonstrated its activation at the mRNA expression level, cell surface protein expression, and functional activity toward CFZ, as well as the possibility of resensitizing cells using a P-gp inhibitor. We also made the first attempt to identify the transcription factor responsible for P-gp upregulation, though our work did not achieve full clarity on this issue at this stage. These results suggest promising directions for overcoming CFZ resistance in MM by suppressing P-gp function and/or expression.

×

About the authors

A. I. Cherkasova

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health of Russia

Email: n.i.moiseeva@gmail.com
ORCID iD: 0000-0003-0236-2796
Russian Federation, 24 Kashirskoe Shosse, Moscow 115522

L. A. Laletina

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health of Russia

Email: n.i.moiseeva@gmail.com
ORCID iD: 0000-0002-8839-5881
Russian Federation, 24 Kashirskoe Shosse, Moscow 115522

K. V. Kalabina

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health of Russia

Email: n.i.moiseeva@gmail.com
Russian Federation, 24 Kashirskoe Shosse, Moscow 115522

E. A. Scherbakova

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health of Russia

Email: n.i.moiseeva@gmail.com
ORCID iD: 0009-0001-5651-1454
Russian Federation, 24 Kashirskoe Shosse, Moscow 115522

N. I. Moiseeva

N.N. Blokhin National Medical Research Center of Oncology, Ministry of Health of Russia

Author for correspondence.
Email: n.i.moiseeva@gmail.com
ORCID iD: 0000-0001-6697-7154
Russian Federation, 24 Kashirskoe Shosse, Moscow 115522

References

  1. Zhou X., Xu R., Wu Y. et al. The role of proteasomes in tumorigenesis. Genes Dis 2023;11(4):101070. doi: 10.1016/j.gendis.2023.06.037
  2. Okazuka K., Ishida T. Proteasome inhibitors for multiple myeloma. Jpn J Clin Oncol 2018;48(9):785–93. doi: 10.1093/jjco/hyy108
  3. Issa M.E., Takhsha F.S., Chirumamilla C.S. et al. Epigenetic strategies to reverse drug resistance in heterogeneous multiple myeloma. Clin Epigenetics 2017;9(1):17. doi: 10.1186/s13148-017-0319-5
  4. Manasanch E.E., Orlowski R.Z. Proteasome inhibitors in cancer therapy. Nat Rev Clin Oncol 2017;14(7):417–33. doi: 10.1038/nrclinonc.2016.206
  5. Kim K.B. Proteasomal adaptations to FDA-approved proteasome inhibitors: a potential mechanism for drug resistance? Cancer Drug Resist 2021;4(3):634–45. doi: 10.20517/cdr.2021.27
  6. Tripathi S.C., Vedpathak D., Ostrin E.J. The functional and mechanistic roles of immunoproteasome subunits in cancer. Cells 2021;10(12):3587. doi: 10.3390/cells10123587
  7. Kuzmich E.V., Pavlova I.E., Bessmeltsev S.S. Sensitization to HLA antigens in patients with multiple myeloma. MEDLINE.RU 2024;25:319–32. (In Russ.).
  8. Woodle E.S., Tremblay S., Brailey P. et al. Proteasomal adaptations underlying carfilzomib-resistance in human bone marrow plasma cells. Am J Transplant 2020;20(2):399–410. doi: 10.1111/ajt.15634
  9. Rajeev Krishnan S., De Rubis G., Suen H. et al. A liquid biopsy to detect multidrug resistance and disease burden in multiple myeloma. Blood Cancer J 2020;10(3):37. doi: 10.1038/s41408-020-0304-7
  10. Kubiczkova L., Pour L., Sedlarikova L. et al. Proteasome inhibitors – molecular basis and current perspectives in multiple myeloma. J Cell Mol Med 2014;18(6):947–61. doi: 10.1111/jcmm.12279
  11. Besse A., Stolze S., Rasche L. et al. Carfilzomib resistance due to ABCB1/MDR1 overexpression is overcome by nelfinavir and lopinavir in multiple myeloma. Leukemia 2018;32(2):391–401. doi: 10.1038/leu.2017.212.
  12. Byrgazov K., Kraus M., Besse A. et al. Up-regulation of multidrug resistance protein MDR1/ABCB1 in carfilzomib-resistant multiple myeloma differentially affects efficacy of anti-myeloma drugs. Leuk Res 2021;101:106499. doi: 10.1016/j.leukres.2020.106499
  13. Bargou R.C., Jürchott K., Wagener C. et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 1997;3(4):447–50. doi: 10.1038/nm0497-447
  14. Bommert K.S., Effenberger M., Leich E. et al. The feed-forward loop between YB-1 and MYC is essential for multiple myeloma cell survival. Leukemia 2013;27(2):441–50. doi: 10.1038/leu.2012.185
  15. Rybalkina E.Y., Moiseeva N.I., Karamysheva A.F. Triterpenoids with modified A-ring as modulators of P-gp-dependent drug-resistance in cancer cells. Chem Biol Interact 2021;348:109645. doi: 10.1016/j.cbi.2021.109645
  16. Laletina L.A., Moiseeva N.I., Klimova D.A., Stavrovskaya A.A. The role of АВС transporters in drug resistance to bortezomib in multiple myeloma. Uspekhi molekulyarnoy onkologii = Advances in Molecular Oncology 2019;6(1):49–56. (In Russ.). doi: 10.17650/2313-805X-2019-6-1-49-56
  17. Moiseeva N.I., Laletina L.A., Fetisov T.I. et al. Analysis of multiple drug resistance mechanism in different types of soft tissue sarcomas: assessment of the expression of ABC-transporters, MVP, YB-1, and analysis of their correlation with chemosensitivity of cancer cells. Int J Mol Sci 2022;23(6):3183. doi: 10.3390/ijms23063183
  18. Lee M.J., Miller Z., Park J.E. et al. H727 cells are inherently resistant to the proteasome inhibitor carfilzomib, yet require proteasome activity for cell survival and growth. Sci Rep 2019;9(1):4089. doi: 10.1038/s41598-019-40635-1
  19. Mynott R.L., Wallington-Beddoe C.T. Inhibition of P-glycoprotein does not increase the efficacy of proteasome inhibitors in multiple myeloma cells. ACS Pharmacol Transl Sci 2021;4(2):713–29. doi: 10.1021/acsptsci.0c00200
  20. Takahashi K., Inukai T., Imamura T. et al. Anti-leukemic activity of bortezomib and carfilzomib on B-cell precursor ALL cell lines. PLoS One 2017;12(12):e0188680. doi: 10.1371/journal.pone.0188680
  21. Kalitin N.N., Chernykh Y.B., Buravtsova I.V. Comparative analysis of quantitative parameters of expression of the retinoic acid nuclear receptor RARα gene and APE1/YB-1/MDR1 pattern genes in patients with newly detected multiple myeloma. Bull Exp Biol Med 2017;164(1):90–4. doi: 10.1007/s10517-017-3931-7

Supplementary files

Supplementary Files
Action
1. JATS XML
2. Fig. 1. Cytotoxic effect of carfilzomib on AMO-1 and AMO-1/CFZ, 72 hours of incubation: a – cells survival curves under the influence of carfilzomib (MTT test); b – statistical significance of the obtained results (t-test)

Download (197KB)
3. Fig. 2. Expression of mRNA genes in the sensitive AMO-1 and the resistant AMO-1/CFZ subline (a) genes PSMB1, PSMB2, PSMB5, encoding catalytic subunits of constitutive proteasomes (b) genes PSMB1i, PSMB2i, PSMB5i, encoding immunoproteasomes and (c) ABCB1 gene, encoding P-gp (real-time polymerase chain reaction, relative expression 2ΔCt), housekeeping gene RPLP0)

Download (166KB)
4. Fig. 3. P-glycoprotein (P-gp) expression in AMO-1 and AMO-1/CFZ cells determined by Western blot, β-actin was used as a loading control (a); P-gp expression in AMO-1 (b) and AMO-1/CFZ cells (c) determined by flow cytometry. FCS-H – forward scatter height

Download (89KB)
5. Fig. 4. Evaluation of carfilzomib (a) and ixazomib (b) effect on the release of Rh123 (fluorescent compound, P-glycoprotein substrate) in P-glycoprotein overexpressing K562/i-S9_Dox cells (flow cytometry). Following a 20-minute incubation period with Rh123, the cells were further incubated for 40 minutes in either fresh medium, or medium containing elacridar, or carfilzomib, or ixazomib

Download (218KB)
6. Fig. 5. Cytotoxic effect of carfilzomib (cfz) combined with P-glycoprotein inhibitor elacridar (ela) on AMO-1 and AMO-1/CFZ cells; ela was added at a concentration of 3 µM for AMO-1 cells and 12 µM for AMO-1/CFZ cells, incubated for 24 hours: a – cell survival curves (MTT assay); b – statistical significance of the obtained results (t-test). ns – no significant

Download (102KB)
7. Fig. 6. YB-1 and p-YB-1 expression levels in AMO-1 and AMO-1/CFZ cells, β-actin was used as a loading control (Western blot) (а). Densitometry was performed based on the Western blot results. Statistical significance of the obtained results (t-test) (b). ns – no significant

Download (54KB)

Copyright (c) 2025 Cherkasova A.I., Laletina L.A., Kalabina K.V., Scherbakova E.A., Moiseeva N.I.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: серия ПИ № ФС 77 - 57560 от  08.04.2014.